Institution: UNIVERSIDAD DE NAVARRA | Sign In via User Name/Password
 
  Donate Help Contact The AHA Sign In Home
American Heart Association
Hypertension
Search: search_blue_button Advanced Search
Hypertension. 1995;25:356-364

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garciandia, A.
Right arrow Articles by Diez, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garciandia, A.
Right arrow Articles by Diez, J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*High Blood Pressure

(Hypertension. 1995;25:356-364.)
© 1995 American Heart Association, Inc.


Articles

Enhanced Na+-H+ Exchanger Activity and NHE-1 mRNA Expression in Lymphocytes From Patients With Essential Hypertension

Ana Garciandia; Rafael López; Javier Tisaire; Arantxa Arrázola; Antonia Fortuńo; José Bueno; Javier Diez

From the Vascular Pathophysiology Unit, Department of Internal Medicine, Center for Biomedical Research, School of Medicine, University of Navarra, Pamplona (A.G., R.L., A.A., A.F., J.D.), and the Department of Medicine, University Hospital, School of Medicine, University of Zaragoza, Zaragoza, Spain (J.T., J.B., J.D.).

Correspondence to Javier Diez, MD, PhD, Unidad de Fisiopatología Vascular, Departamento de Medicina Interna, Centro de Investigaciones Biomédicas, Facultad de Medicina, C/ Irunlarrea s/n, 31080 Pamplona, Spain.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract It has been demonstrated that the activity of the sodium-proton exchanger (NHE-1 isoform) is increased in lymphocytes and other blood cells from patients with essential hypertension. In the present study, we investigated whether an increased level of NHE-1–specific mRNA in lymphocytes from patients with essential hypertension would explain the enhanced transport activity. Twenty-two hypertensive patients and 21 normotensive subjects were studied. Basal cytosolic pH was measured by the pH-sensitive fluorescent probe 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein. Maximal sodium-proton exchange activity was determined by acidifying cell pH and measuring the initial rate of the net sodium-dependent proton efflux driven by an outward proton gradient. The transcript level of NHE-1 was measured by reverse transcription–polymerase chain reaction in comparison with a constitutively expressed reference gene (ß-actin). Intracellular pH was lower in hypertensive patients than normotensive subjects (7.34±0.01 versus 7.39±0.01, mean±SEM, P<.001). The maximal activity of the sodium-proton exchanger was higher in hypertensive patients than in normotensive subjects (1262±100 versus 881±56 mmol/L cells per hour, P<.01). NHE-1 mRNA was increased in hypertensive patients compared with normotensive subjects (ratio of NHE-1 mRNA to ß-actin mRNA, 0.16±0.01 versus 0.12±0.02, P<.05). These data suggest that the increased sodium-proton exchange activity in essential hypertension may be related to the de novo synthesis of exchanger protein.


Key Words: hypertension, essential • lymphocytes • Na+-H+ exchanger • NHE-1 isoform


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
An Na+-H+ exchanger has been detected in the plasma membrane of all mammalian cells studied; this transport system exchanges extracellular Na+ for intracellular H+ with a stoichiometric ratio of 1:1.1 In arterial hypertension, enhanced activity of the Na+-H+ exchanger has been described in various cell types (for review, see Reference 22 ). For instance, increased activity of the Na+-H+ exchanger has been found in lymphocytes from spontaneously hypertensive rats3 and from patients with essential hypertension.4 The question of whether this increase in Na+-H+ exchange activity is attributable to modifications of the exchanger turnover rate or to an increase in the number of exchanger units available for transport is still under debate.2

Several isoforms of the Na+-H+ exchanger protein have been cloned in mammalian cells and termed NHE-1, NHE-2, NHE-3, and NHE-4.5 6 7 8 9 Recent studies indicate that human lymphocytes express the mRNA encoding for the NHE-1 isoform of the Na+-H+ exchanger.10 Several observations suggest that NHE-1 participates in intracellular pH regulation11 and cellular volume homeostasis.12 Furthermore, NHE-1 appears to play a role in the initiation of cell growth.11

We designed the present study to investigate whether the enhanced Na+-H+ exchange activity detectable in lymphocytes from essential hypertensive patients could be explained by a parallel increase in NHE-1 mRNA levels. We investigated the steady-state levels of NHE-1 mRNA using a quantitative polymerase chain reaction (PCR) assay.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Subjects
Twenty-two white hypertensive patients were selected from the Hypertension Unit of the University Hospital at the University of Zaragoza. These patients were considered to have essential hypertension (no known cause of high blood pressure and no associated disease detected after medical examination). None of the patients had received antihypertensive therapy before the study.

The control group consisted of 21 white normotensive subjects. These control subjects were normotensive patients of the outpatient clinics of the University Hospital at the University of Zaragoza.

The study was approved by the institutional Ethics Committee, and all subjects gave informed consent before inclusion. All subjects were studied under the conditions of an unlimited Na+ diet.

Clinical Studies
Medical examination consisted of a complete medical history, physical examination, and radiological, biochemical, and hormonal evaluations.13 The biochemical evaluation included determination of plasma glucose and plasma renin activity; measurement of serum cholesterol, potassium, bicarbonate, and creatinine; and determination of urinary sodium and creatinine. Blood samples were drawn with subjects in a fasting condition at 8 AM. Biochemical parameters were measured by routine laboratory methods. Plasma renin activity was estimated by radioimmunoassay for angiotensin I (Sorin, Sallugia).14 Creatinine clearance was calculated according to the standard formula: Creatinine Clearance=Urinary CreatininexUrinary Output (per minute)/Serum Creatinine.

Isolation of Lymphocytes
Early in the morning, venous blood (90 mL) was drawn from each subject maintained in fasting conditions. Blood was collected in heparinized tubes and diluted with an equal quantity of 0.9% NaCl. This solution was layered onto a sterile sodium metrizoate/Ficoll mixture (Lymphoprep, Nycomed, Pharma AS) and centrifuged at 800g for 15 minutes at 20°C. The thin lymphocyte layer resting on the density interface was collected and divided into two portions. One portion (40x106 cells) was washed three times in 0.9% NaCl, and the cells were homogenized in 4 mL guanidium isothiocyanate lysis buffer for the preparation of RNA and stored at -80°C until further manipulations. The remaining cells were used for the measurement of intracellular pH and the determination of Na+-H+ exchange activity. These cells were washed twice with a solution containing (mmol/L) NaCl 118, NaHCO3 20, KCl 2, MgCl2 1, CaCl2 1, glucose 10, and Tris-3-(N-morpholino)propanesulfonic acid (MOPS) 15, pH 7.4, at 37°C. The cells were resuspended in the same solution and kept at room temperature ready for use.

Measurement of Intracellular pH
Intracellular pH was measured fluorometrically using the pH-sensitive carboxyfluorescein derivative 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF) (Molecular Probes).15 Lymphocytes were incubated at a concentration of 20x106/mL with BCECF-AM (5 µmol/L) for 30 minutes at 37°C in the above-mentioned medium. After incubation, the cells were washed twice and resuspended in medium that lacked the dye. The dye-loaded cells were kept at 20°C until ready for use.

Fluorescence determinations were carried out at 37°C with a flow cytometer (FACScan, Becton Dickinson) with excitation and emission wavelengths set at 488 and 530 nm, respectively. Intracellular pH was calculated from the BCECF fluorescence signals using the slope and intercept of a calibration line generated for each experiment. The calibration curve was performed using the nigericin technique described by Thomas et al.16 The calibration solutions contained (mmol/L) KCl 140, MgCl2 1, CaCl2 1, glucose 10, nigericin 0.020, and Tris-2-(N-morpholino)ethanesulfonic acid (MES) 20, for pH lower than 7.0, and Tris-MOPS 20, for pH higher than 7.0. The solutions were titrated to an external pH between 6.0 and 7.6 (at least five points) using dilute acid (HCl) or base (Tris base). Over this pH range, the fluorescence increased linearly with pH (r>=.998).

Measurement of Buffering Power
Buffering power was determined as described by Roos and Boron.17 The resting intracellular pH of BCECF-loaded lymphocytes was first determined. Then 5 mmol/L NH4Cl was added to the cell suspension, and the new intracellular pH was recorded. The buffering power was calculated as the ratio of {Delta}intracellular NH4+ to {Delta}intracellular pH, where {Delta}intracellular NH4+ equals the rise in NH4+ produced by the alkaline pulse and {Delta}intracellular pH is the difference between resting intracellular pH and intracellular pH after the NH4Cl pulse. The intracellular NH4+ concentration was calculated using a pKa for NH3 at 37°C of 8.89 and assuming that NH3 is in equilibrium across the cell membrane.17

Measurement of Na+-H+ Exchange Activity
For the analysis of Na+-H+ exchange activity, intracellular pH was acidified in a portion of the BCECF-loaded cells. Acidification of lymphocyte pH was performed as follows: Cells were incubated in an acid-loading solution with 2 µmol/L nigericin for 5 minutes in a shaking water bath at 37°C. The acid-loading solution contained (mmol/L) KCl 150, MgCl2 1, CaCl2 1, glucose 10, and Tris-MES 20, pH 6.0, at 37°C. The cells were then washed and resuspended in an identical medium at the same pH but which lacked the ionophore and contained in addition fatty acid–free albumin (1 mg/mL) to scavenge residual nigericin.

Na+-H+ exchange activity was assayed as the initial rate of change in intracellular pH after an acid load. To measure the activity of the Na+-H+ exchanger, we compared the rate of intracellular pH recovery in acid-loaded lymphocytes in the presence and absence of Na+ (Na+ had been replaced with an equimolar amount of Ch+) as previously reported.18 The composition of the medium was (mmol/L) NaCl (or choline chloride) 140, KCl 2, MgCl2 1, CaCl2 1, glucose 10, and Tris-MOPS 20, pH 8.0, at 37°C. Both media were nominally HCO3- free. These were also the optimal conditions for promoting maximal exchange activity.18

Na+-dependent intracellular pH recovery was analyzed by fitting the intracellular pH versus time record to a single-exponential function (Fig 1),19 and its value (V) was estimated from the equation



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Line graph shows time course of Na+-H+–dependent intracellular pH recovery ({Delta}pHi) after acid load of lymphocytes. For calculation of initial rate, a straight line was fit to the data as shown in inset. {Delta}pHimax indicates maximal intracellular pH recovery (see "Methods").


where K is the slope of the linear regression line, {Delta}intracellular pHmax is the maximal difference of intracellular pH recovery between cells incubated in media with and without Na+, and t is the time (in hours).

The initial rate of Na+-dependent H+ efflux was calculated multiplying V by the buffering power measured for cells at that particular intracellular pH and was expressed in millimoles per liter of cells per hour. In control experiments (n=3), 100 µmol/L amiloride inhibited more than 97% of the Na+-dependent H+ efflux. We also examined the kinetics of amiloride inhibition of Na+-dependent H+ efflux. The data indicated half-maximal inhibition of Na+-dependent H+ efflux at an amiloride concentration of 5 µmol/L. Therefore, this Na+-dependent H+ efflux was considered to represent the maximal activity (or Vmax) of the Na+-H+ exchanger in lymphocytes.

RNA Extraction
Total cell RNA was obtained using the guanidinium isothiocyanate–phenol–chloroform method.20 Briefly, 400 µL of 2 mol/L sodium acetate (pH 4.3), 4 mL of water-saturated phenol, and 1 mL of chloroform/isoamilic alcohol (49:1) were added to homogenized cells. RNA was precipitated with 2.5 vol ethanol, and the pellet was washed with ethanol at 75%. The resultant pellet was vacuum dried and resuspended in diethyl pirocarbonate–treated water. The RNA concentration was spectrophotometrically determined, and RNA was stored at -80°C.

cDNA Synthesis
For reverse transcription (RT) reaction, we used 1 µg total RNA in a final volume of 20 µL. The following reagents were added to the mix reaction: 2 µL RT buffer (GIBCO BRL), 5 mmol/L each deoxy-nucleotide-triphosphate (Boehringer Mannheim Biochemica GmbH), 100 ng/µL random hexamers (Boehringer Mannheim), 200 U Moloney murine leukemia virus RT (GIBCO BRL), 5 mmol/L dithiothreitol, and 20 U RNAsin (Pharmacia Biotech Inc). cDNA synthesis proceeded for 60 minutes at 37°C and was stopped by heat (5 minutes at 95°C) and finally quick chilled in ice.

PCR Conditions
Before the quantitation assays, PCR optimal conditions were determined for three parameters: Mg2+ concentration, primer concentration, and primer annealing temperature for both NHE-1 and ß-actin cDNA amplification. The conditions chosen were as follows: for NHE-1, 1.5 mmol/L, 100 ng/µL each primer, and 57°C; for ß-actin, 1.5 mmol/L, 40 ng/µL each primer, and 57°C. Oligonucleotides (5'-3') d(CTTCCTCTACAGCTACATGG) and d(CATAGGCGATGATGAACTGG) were upstream and downstream primers, respectively, used for amplification of a 342 bp fragment (nucleotides 1409-1751) from human NHE-1 cDNA.21 Oligonucleotides (5'-3') d(TCTACAATGAGCTGCGTGTG) and d(GGTGAGGATCTTCATGAGGT) were used to amplify a 314 bp fragment from human ß-actin cDNA located between nucleotides 1319 and 2079 in the reported human ß-actin gene sequence.22 The final volume of the PCR reaction was 50 µL, with 2 U of Taq polymerase (Promega) and 3 µCi of [32P]dCTP (Amersham). The mixture was overlaid with 50 µL mineral oil and amplified in a GeneAtaq Thermocicler (Pharmacia Biotech AB). NHE-1 cDNA fragments were amplified by 25 cycles and ß-actin fragments by 20 cycles with the following amplification profile: 94°C, 57°C, and 72°C at 1 minute for each step.

Although we performed the RT reaction in the same reaction tube, we carried out PCR reactions for NHE-1 and ß-actin in separate tubes because variable amplification efficiency was observed when PCR was performed in the same tube.

Electrophoresis and Radioactivity Determinations
After amplification, 19-µL aliquots of the PCR reactions were electrophoresed on a 2% agarose gel, and bands were visualized by ethidium bromide. Bands of equal size were excised from the gel and radioactivity measured in a ß liquid scintillation counter (LKB Wallec). The obtained values were corrected with background radioactivity from blank reactions without RNA input. Finally, values corresponding to NHE-1 amplification were normalized with those for ß-actin amplification.

Statistical Analysis
Values are expressed as mean and range or mean±SEM. Student's t test for single comparisons of quantitative parameters was used to assess statistical significance between normotensive subjects and hypertensive patients. The correlation between continuously distributed variables was tested by univariate regression analysis.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Characteristics of the Study Populations
As can be seen in the Table, hypertensive patients were similar to normotensive subjects in age, sex distribution, and body mass index but had significantly higher blood pressure levels. According to blood pressure levels, hypertensive patients were considered to have mild to moderate hypertension. Plasma glucose and serum cholesterol levels were similar in the two groups. None of the hypertensive patients exhibited hyperglycemia or hypercholesterolemia. No significant differences were observed in blood and urine electrolytes between the two groups. None of the hypertensive patients exhibited plasma bicarbonate or serum potassium levels below the reference lower limit in the laboratory of the University Hospital (23 and 3.5 mmol/L, respectively). Creatinine clearance and PRA values were similar in the two groups.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical, Biochemical, and Hormonal Parameters in Normotensive Subjects and Hypertensive Patients

Intracellular pH and Buffering Power
Intracellular pH values obtained in lymphocytes from 21 normotensive subjects ranged from 7.26 to 7.48 (mean, 7.39±0.01) (Fig 2). The reproducibility of the pH measurement was assessed by calculating the index of intra-assay variation in three samples (<0.20%) and the mean coefficient of interassay variation in four subjects (<0.20%). Intracellular pH was diminished (P<.001) in hypertensive (7.34±0.01) compared with normotensive (Fig 2) individuals.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 2. Data points show lymphocyte intracellular pH in normotensive subjects (NT) and hypertensive patients (HT).

Buffering power was lower (P<.01) in lymphocytes from hypertensive patients compared with lymphocytes from normotensive subjects (8.66±0.45 versus 12.80±1.30 mmol H+/L cells per pH unit).

Na+-H+ Exchange Activity
The Na+-dependent H+ efflux measured in lymphocytes from normotensive and hypertensive individuals is presented in Fig 3. Maximal exchange activity in normotensive subjects ranged from 485 to 1367 mmol H+/L cells per hour (mean, 881±56 mmol/L cells per hour). Measurement of the exchanger had an index of intra-assay variation and a mean coefficient of interassay variation of 1% (n=3) and 2% (n=4), respectively. Maximal Na+-H+ exchange activity was increased (P<.01) in lymphocytes from hypertensive patients (1262±100 mmol H+/L cells per hour) compared with lymphocytes from normotensive subjects.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. Data points show maximal activity of the Na+-H+ exchanger in normotensive subjects (NT) and hypertensive patients (HT).

Maximal Na+-H+ exchange activity was directly correlated with systolic pressure (r=.371, P<.05, y=121+0.013x), diastolic pressure (r=.442, P<.01, y=73.2+0.014x), and mean arterial pressure (r=.448, P<.01, y=89+0.013x) (Fig 4) in all subjects. No correlation was found between exchange activity and intracellular pH.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 4. Scatterplot shows correlation between Na+-H+ exchange activity and mean arterial pressure (MAP) in all subjects (r=.448, P<.01, y=89+0.013x). {circ} indicates normotensive subjects; {bullet}, hypertensive patients.

PCR Amplification of Sequences Encoding for NHE-1 and ß-Actin
The main problem of PCR-based quantitative methods arises from their great sensitivity. DNA amplification by PCR represents an exponential reaction, reaching a plateau effect at higher cycle numbers. The kinetic behavior of the process implies that small changes in amplification efficiency may significantly influence the final amounts of PCR product. However, quantitation requires accurate measurement in the phase of exponential amplification. Thus, we made amplification profiles for NHE-1 and ß-actin to test the amount of RNA input and the cycle number needed to find the exponential range in the RT-PCR reaction. These experiments were performed using different amounts of RNA input in the RT reaction. Then, in the PCR process, the reaction was stopped each five cycles, and 7-µL aliquots were loaded onto an electrophoresis agarose gel. Kinetic behavior was assessed by addition of a 32P-labeled nucleotide (Fig 5). The arrows in Fig 5 indicate the amount of RNA and the number of cycles chosen for each cDNA amplification in further quantitative assays (500 ng RNA and 25 cycles for NHE-1; 300 ng RNA and 20 cycles for ß-actin).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 5. Line graphs show ß-actin amplification profile (top) and NHE-1 amplification profile (bottom). To find the exponential range in polymerase chain reaction (PCR) for accurate quantitation assays, we made a series of reverse transcription–PCR reactions in which different amounts of RNA input were tested at different PCR cycles. Obtained values (cpm) were plotted on a curve. Arrows indicate the final amount of RNA and the number of cycles chosen for each cDNA amplification assay.

To assess whether the levels of ß-actin remain unchanged,23 we carried out an RT-PCR reaction to amplify the ß-actin cDNA fragment in six normotensive subjects and five hypertensive patients randomly selected. As shown in Fig 6, the values measured in the two groups of subjects were not significantly different (68 553±7416 cpm in hypertensive patients and 66 251±4165 cpm in normotensive subjects).



View larger version (7K):
[in this window]
[in a new window]
 
Figure 6. Data points show that expression levels of the housekeeping gene ß-actin remained unchanged in normotensive subjects (NT) compared with hypertensive patients (HT).

A representative photograph of the method is shown in Fig 7.



View larger version (82K):
[in this window]
[in a new window]
 
Figure 7. Blots show an example of the reverse transcription–polymerase chain reaction quantitative method in three subjects. Lanes 1 and 6, molecular DNA weight markers; lanes 2, 3, and 4, NHE-1 amplified fragments; lane 5, NHE-1 blank reaction; lanes 7, 8, and 9, ß-actin amplified fragments; and lane 10, ß-actin blank reaction.

Analysis of NHE-1– and ß-Actin–Specific PCR Products
The identity of the PCR products from NHE-1 and ß-actin cDNA amplification was verified. The ß-actin amplified fragment was digested with BstEII and Bgl II. BstEII yielded the predicted restriction fragments (205 and 109 bp), and Bgl II did not digest the amplified PCR product (no restriction site for this endonuclease is present in the amplified region) (Fig 8). The NHE-1 amplified fragment was purified and cloned in a p-GEM-t plasmid (Promega) and sequenced following a conventional dideoxy method (Fig 9).24



View larger version (83K):
[in this window]
[in a new window]
 
Figure 8. Blots show ß-actin amplified fragment digested with Bgl II and BstEII. Lanes 1 and 4, molecular DNA weight markers; lane 2, ß-actin fragment digested with Bgl II (314 bp); and lane 3, ß-actin fragment digested with BstEII (205+109 bp).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 9. Blots show portion of the sequence of the NHE-1 amplified fragment. A indicates adenine; C, cytosine; G, guanine; and T, thymine.

Changes in NHE-1 Expression in Human Lymphocytes in Hypertension
The results of NHE-1 expression obtained in lymphocytes in the two groups of subjects studied are presented in Fig 10. The steady-state level of lymphocyte NHE-1 mRNA in normotensive subjects ranged from 0.01 to 0.26 (mean, 0.12±0.02). To assess the reproducibility of our assay, we calculated the index of intra-assay variation in nine samples (13%) and the mean coefficient of interassay variation in nine subjects (31%). NHE-1 transcript levels were elevated (P<.05) in hypertensive patients (0.16±0.01) with respect to normotensive subjects. No correlations were found between NHE-1 mRNA levels and either intracellular pH or Na+-H+ exchange activity.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 10. Data points show the ratio of NHE-1– to ß-actin–specific transcript levels in normotensive subjects (NT) and hypertensive patients (HT).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In this study we measured Na+-H+ exchange activity under maximal conditions in lymphocytes of normotensive subjects and hypertensive patients. The maximal activity of the exchanger was higher in hypertensive patients than in normotensive subjects, with an enhancement factor of 1.43. This finding is in agreement with previous data showing increased Na+-H+ exchange transport activity in lymphocytes from spontaneously hypertensive rats3 and patients with essential hypertension.4 Furthermore, Na+-H+ exchange activity was positively correlated with blood pressure in all subjects. Lymphocyte Na+-H+ exchange has been shown to be correlated with systolic pressure in normotensive individuals,25 but this is the first time that exchange activity has been correlated with blood pressure in hypertensive patients.

The mechanisms by which the Na+-H+ exchanger is activated in essential hypertensive patients could include changes in the intracellular buffer capacity for H+, modifications of intracellular pH, and variations of cellular volume.26 An enhanced Na+-H+ exchange activity might be caused by a reduced buffer capacity for H+ in hypertensive patients. Although a reduced buffer capacity was found in cells from hypertensive patients in the present study, previous investigations have excluded any relation between the two parameters in hypertension.27 28

We have found that resting intracellular pH is diminished in lymphocytes from hypertensive patients compared with those from normotensive subjects. This is in agreement with the previous observation by Batlle et al29 of a reduced intracellular pH in lymphocytes from the spontaneously hypertensive rat. It has been shown that the human lymphocyte Na+-H+ exchanger is activated by an intracellular pH lower than 7.0, with a pK of 6.57.18 Thus, the lymphocyte Na+-H+ exchanger appears not to be involved in the regulation of resting intracellular pH. Accordingly, we believe that the activation of the exchanger seen in hypertensive patients cannot be attributed to the diminished resting intracellular pH present in their lymphocytes.

On the other hand, the involvement of the Na+-H+ exchanger in cellular volume regulation occurs under specific circumstances, namely, the acute response to cellular volume shrinkage associated with increased osmolality of the extracellular medium.30 Although we did not measure lymphocyte volume in the present study, other authors have found that the cell volume of lymphocytes is increased in hypertensive compared with normotensive individuals.4 Thus, it appears that changes in lymphocyte volume are not involved in the stimulation of Na+-H+ exchange activity in hypertension.

It has been previously demonstrated in lymphocytes from healthy subjects that Na+-H+ exchange activity is related to both the fluidity of the membrane and serum cholesterol.25 However, no associations were found in the present study between serum cholesterol and exchange activity, suggesting that changes in membrane fluidity do not account for the increased Na+-H+ exchange activity in hypertensive patients.

Conflicting results have been reported in the literature concerning the effects of several hormones, namely, aldosterone and insulin, on Na+-H+ exchange activity. Although Wehling et al31 reported a stimulatory effect of aldosterone on the lymphocyte exchanger, Quednau et al32 found no such effect. On the other hand, whereas some in vitro studies have demonstrated that erythrocyte Na+-H+ exchange activity may be stimulated by incubation with insulin,33 34 other studies failed to observe a similar effect in lymphocytes.25 Neither aldosterone nor insulin was measured in plasma from subjects in the present study. Nevertheless, none of the hypertensive patients exhibited biochemical features suggesting the existence of hyperaldosteronism or hyperinsulinemia.

It has been postulated that changes in cytosolic Ca2+ and Na+-H+ exchange activity in essential hypertension are closely linked, the rise in cytosolic Ca2+ being the cause of enhanced exchange activity.35 However, this theory is weakened when one considers that normal values for cytosolic Ca2+ fall in the nanomolar range and that cytosolic Ca2+ must be elevated to the micromolar range until an activation of the exchanger is observable,36 which is hardly likely.

Protein kinase C enhances the activity of the Na+-H+ exchanger.36 Thus, it could be proposed that an increased protein kinase C activity in essential hypertension should activate the exchanger via increased phosphorylation. However, no evidence has yet been provided that protein kinase C activity is increased in essential hypertension. On the other hand, phosphorylation of the Na+-H+ exchanger should result in kinetic changes opposite to those reported in the literature in hypertensive patients.2 37

Since there is no apparent explanation for the increased maximal activity of the Na+-H+ exchanger in lymphocytes from essential hypertensive patients, we established an RT-PCR assay to investigate whether an increase in NHE-1 mRNA levels would occur, thereby explaining the increase in exchanger activity.

Conventional specific techniques for gene expression measurement include Northern blot and RNase protection assay. However, these methods are not sensitive enough to detect mRNA in samples limited by either low copy number per cell or low cell number. Although the NHE-1 gene is ubiquitously expressed in all cell types so far studied, it is still unknown whether a low number of copies is present in the human lymphocyte. On the other hand, according to the protocol approved by the institutional Ethics Committee of our hospital, only 90 mL of blood was drawn from each subject to measure transport activity and mRNA expression. This meant that a maximal number of 40x106 cells was available to measure lymphocyte NHE-1 mRNA in each subject.

We therefore chose the RT-PCR method, which after amplification, allows for the identification of specific cDNA copies with low levels of mRNA, far below the detection limit of the above-mentioned techniques.38 39 In addition, recent studies in which RT-PCR was validated with respect to the above-mentioned techniques have demonstrated that the amount of mRNA estimated by the RT-PCR method correlated closely with the results of Northern blot analysis40 and RNase protection assay.41

Amplification of the target sequence with a constitutively expressed reference gene has been frequently applied to measure relative changes in mRNA levels.42 43 44 Thus, we chose to amplify the ß-actin gene as a standard. Our results indicate that lymphocyte ß-actin mRNA abundance remained unchanged in lymphocytes from patients with essential hypertension.

The main finding of the present study is that the steady-state level of lymphocyte NHE-1 mRNA was significantly increased in hypertensive patients with respect to normotensive subjects. This observation is in disagreement with recent results by Rosskopf et al.45 These authors were unable to find increased steady-state NHE-1 mRNA transcript levels in immortalized lymphoblasts from essential hypertensive patients. However, several reasons may account for the apparent discrepancy. First, Rosskopf et al measured NHE-1 mRNA in cultures of lymphoblasts grown from Epstein-Barr virus–infected lymphocytes. Thus, the specific characteristics of each cellular model may explain the different results. Second, Rosskopf et al analyzed NHE-1 mRNA expression by Northern blot. Therefore, differences in methodology may also influence the diversity of findings. Finally, Rosskopf et al measured NHE-1 mRNA levels in a small group of nine male normotensive subjects and a small group of 10 male hypertensive patients. In addition, numerical data relative to results of the Northern blot analysis suggest that a great interindividual variation occurs in the hypertensive group. It is likely that with the use of a larger group of hypertensive and normotensive individuals, the differences could reach statistical significance, as has occurred in the present study.

Studies on rats and cultured cells of renal origin have demonstrated that metabolic acidosis enhances both Na+-H+ exchange activity and NHE-1 mRNA transcript levels.46 47 48 Very recently, Quednau et al32 have found enhanced Na+-H+ exchange activity and NHE-1 mRNA levels in human lymphocytes during metabolic acidosis. Therefore, it appears that long-term metabolic acidosis influences the regulation of the Na+-H+ exchanger at the transcriptional level. Since none of the patients included in the present study exhibited metabolic acidosis, this cause can be excluded as being responsible for the enhanced expression of the NHE-1 gene seen in hypertensive patients.

Intracellular acidosis has been hypothesized as a possible mechanism of induction of expression of the Na+-H+ exchanger.49 Although an association was found in the present study between diminished intracellular pH and enhanced NHE-1 mRNA levels in lymphocytes from hypertensive patients, additional studies are needed to ascertain whether a causal relation exists between the two alterations.

Several other factors have been shown to be involved in the regulation of NHE-1 mRNA levels in a variety of cell types. For instance, in vascular smooth muscle, serum and platelet-derived growth factor increase NHE-1 mRNA levels.50 51 Further experiments are required to elucidate the possible role of these factors in the overexpression of NHE-1 mRNA in essential hypertension.

Our results show that the enhancement of maximal Na+-H+ exchange activity in essential hypertension is accompanied by a corresponding increase in NHE-1 mRNA abundance. The level of NHE-1 mRNA was increased by a factor of approximately 1.33 in hypertensive patients compared with normotensive subjects. This value is similar to the value by which the maximal activity was enhanced in lymphocytes from hypertensive patients compared with normotensive subjects. Nevertheless, no correlation was found in this study between the two parameters. Therefore, our findings do not prove a causal relation between increased transport activity and the rise in NHE-1 mRNA. Further investigations are required to confirm whether the number of exchangers is increased in lymphocyte membranes from patients with essential hypertension.

It is unknown whether lymphocytes express other Na+-H+ exchanger isoforms (ie, NHE-2, NHE-3, or NHE-4). Whether essential hypertension can stimulate the expression of these additional isoforms of the Na+-H+ exchanger in lymphocytes remains unknown. Thus, our study does not exclude the possibility that the transcription of additional isoforms of the exchanger is enhanced in hypertension, thereby contributing to the observed enhancement of Na+-H+ exchange activity. Subsequent studies should be performed to investigate this issue.

In summary, our finding of increased expression of the NHE-1 isoform of the Na+-H+ exchanger in lymphocytes from patients with essential hypertension might be indicative of an increased number of transporters in this condition. In turn, this could explain the increased maximal transport activity of the exchanger seen in lymphocytes from the same patients. The mechanism underlying this genetic change in hypertension remains to be defined.


*    Acknowledgments
 
This work was supported by grant PB92-0753 from the Dirección General de Investigación Científica y Técnica, Spain. The authors thank Carmen Miqueo for her technical assistance.

Received August 8, 1994; first decision September 2, 1994; accepted November 7, 1994.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1 Manhensmith RL, Aronson PS. The plasma membrane sodium-hydrogen exchanger and its role in physiological and pathophysiological processes. Circ Res. 1985;57:773-788.

2 Rosskopf D, Düsing R, Siffert W. Membrane sodium-proton exchange and primary hypertension. Hypertension. 1993;21:607-617. [Abstract/Free Full Text]

3 Feig PU, D'Occhio MA, Boylan JW. Lymphocyte membrane Na+/H+ exchange in spontaneously hypertensive rats. Hypertension. 1987;9:282-288. [Abstract/Free Full Text]

4 Wehling M, Käsmayr J, Theisen K. The Na+-H+ exchanger is stimulated and cell volume increased in lymphocytes from patients with essential hypertension. J Hypertens. 1991;9:519-524. [Medline] [Order article via Infotrieve]

5 Orlowski J, Kandasamy RA, Shull GE. Molecular cloning of putative members of the Na/H exchanger gene family: cDNA cloning, deduced amino acid sequence, and mRNA tissue expression of the rat Na/H exchanger NHE-1 and two structurally related proteins. J Biol Chem. 1992;267:9331-9339. [Abstract/Free Full Text]

6 Sardet C, Franchi A, Pouysségur J. Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+-H+ antiporter. Cell. 1989;56:271-280. [Medline] [Order article via Infotrieve]

7 Takaichi K, Wang D, Balkovetz DF, Warnock DG. Cloning, sequencing, and expression of Na+-H+ antiporter cDNAs from human tissues. Am J Physiol. 1992;262:C1069-C1076. [Abstract/Free Full Text]

8 Tse CM, Brant SR, Walker MS, Pouysségur J, Donowitz M. Cloning and sequencing of a rabbit cDNA encoding an intestinal and kidney-specific Na+/H+ exchanger isoform (NHE-3). J Biol Chem. 1992;267:9340-9346. [Abstract/Free Full Text]

9 Tse CM, Levine SA, Yun CHC, Montrose MH, Little PJ, Pouysségur J, Donowitz M. Cloning and expression of a rabbit cDNA encoding a serum-activated ethylisopropyl-amiloride-resistant epithelial Na+/H+ exchanger isoform (NHE-2). J Biol Chem. 1992;268:11917-11924. [Abstract/Free Full Text]

10 Quednau B, Rosskopf H, Weiler-Güttler H, Siffert W. Detection of Na+/H+ exchanger mRNA in human neutrophils and lymphocytes using the polymerase chain reaction. FEBS Lett. 1991;289:221-223. [Medline] [Order article via Infotrieve]

11 Wakabayashi S, Fafournoux P, Sardet C, Pouysségur J. The Na+/H+ antiporter cytoplasmic domain mediates growth factor signals and controls `H+-sensing.' Proc Natl Acad Sci U S A. 1992;89:2424-2428. [Abstract/Free Full Text]

12 Grinstein S, Woodside M, Sardet C, Pouysségur J, Rotin D. Activation of the Na+/H+ antiporter during cell volume regulation: evidence for a phosphorylation-independent mechanism. J Biol Chem. 1992;267:23823-23828. [Abstract/Free Full Text]

13 Müller FB, Laragh JH. Clinical evaluation and differential diagnosis of the individual hypertensive patient. In: Laragh JH, Brenner BM, eds. Hypertension: Pathophysiology, Diagnosis, and Management. New York, NY: Raven Press Publishers; 1990:1385-1396.

14 Brunner HR, Laragh JH, Baer L, Cragoe EJ Jr. Essential hypertension: renin, aldosterone, and heart attack and stroke. N Engl J Med. 1972;286:441-449.

15 Rink TJ, Tsien RY, Pozzan T. Cytoplasmic pH and free Mg2+ in lymphocytes. J Cell Biol. 1979;95:189-196. [Abstract/Free Full Text]

16 Thomas JA, Buchbaum RN, Zimniak A, Racker E. Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry. 1979;18:2210-2218. [Medline] [Order article via Infotrieve]

17 Roos A, Boron WF. Intracellular pH. Physiol Rev. 1981;61:296-434. [Free Full Text]

18 Strazzullo P, Canessa M. Kinetics of the human lymphocyte Na+-H+ exchanger. Clin Sci. 1990;79:531-536. [Medline] [Order article via Infotrieve]

19 Alonso A, Arrázola A, Garciandía A, Esparza N, Gómez-Alamillo C, Díez J. Erythrocyte anion exchanger activity and intracellular pH in essential hypertension. Hypertension. 1993;22:348-356. [Abstract/Free Full Text]

20 Chomczynsky P, Sacchi N. Single-step RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159. [Medline] [Order article via Infotrieve]

21 Takaichi K, Wang D, Balkovetz DF, Warnock DG. Cloning, sequencing, and expression of Na+/H+ antiporter cDNAs from human tissues. Am J Physiol. 1992;262:C1069-C1076.

22 Ng SY, Grunning P, Eddy H, Ponte P, Leavitt J, Shows T, Kedes L. Evolution of the functional human beta-actin gene and its multipseudogene family: conservation of noncoding regions and chromosomal dispersion of pseudogenes. Mol Cell Biol. 1985;5:2720-2732. [Abstract/Free Full Text]

23 Siebert PD, Larrick JW. Competitive PCR. Nature. 1992;359:557-558. [Medline] [Order article via Infotrieve]

24 Sanger F, Nickelen S, Coulson AR. DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74:5463-5467. [Abstract/Free Full Text]

25 Carr P, Taub NA, Watta GF, Poston L. Human lymphocyte sodium-hydrogen exchange: the influences of lipids, membrane fluidity, and insulin. Hypertension. 1993;21:344-352. [Abstract/Free Full Text]

26 Wakabayashi S, Sardet C, Fafournoux L, Counillon L, Meloche S, Pages S, Pouysségur J. Structure function of the growth factor activatable Na+/H+ exchanger (NHE1). Rev Physiol Biochem Pharmacol. 1992;119:157-186. [Medline] [Order article via Infotrieve]

27 Ng LL, Fennell DA, Dudley C. Kinetics of the human leucocyte Na+/H+ antiport in essential hypertension. J Hypertens. 1990;8:533-537. [Medline] [Order article via Infotrieve]

28 Tokudome G, Tomonari H, Gardner JP, Aladjem M, Fine BP, Lasker N, Gutkin M, Byrd LH, Aviv A. Variations in the apparent set point for activation of platelet Na+/H+ antiport. Hypertension. 1990;16:180-189. [Abstract/Free Full Text]

29 Batlle DC, Saleh A, Rombola G. Reduced intracellular pH in lymphocytes from the spontaneously hypertensive rat. Hypertension. 1990;15:97-103. [Abstract/Free Full Text]

30 Grinstein S, Goetz-Smith JD, Stewart D, Beresford BJ, Mellors A. Protein phosphorylation during activation of Na/H exchanger by phorbol esters and by osmotic shrinking. J Biol Chem. 1986;261:8009-8016. [Abstract/Free Full Text]

31 Wehling M, Käsmayr J, Theisen K. Rapid effects of mineralocorticoids on sodium-proton exchanger: genomic or nongenomic pathway. Am J Physiol. 1991;260:E719-E726. [Abstract/Free Full Text]

32 Quednau B, Rosskopf D, Reusch HP, Luft FC, Siffert W. Enhanced Na+-H+ exchanger activity and NHE-1 mRNA levels in human lymphocytes during metabolic acidosis. Am J Physiol. 1994;266:C480-C488. [Abstract/Free Full Text]

33 Foyle WJ, Drury PL. Reduction of Li+-Na+ countertransport by physiological levels of insulin in vitro. J Hypertens. 1991;9:713-717. [Medline] [Order article via Infotrieve]

34 Canessa M, Zerbini G, Laffel LMB. Sodium activation kinetics of red blood cell Na+-Li+ countertransport in diabetes: methodology and controversy. J Am Soc Nephrol. 1992;3:S41-S49.

35 Aviv A, Livne A. The Na+-H+ antiport, cytosolic free Ca2+, and essential hypertension: a hypothesis. Am J Hypertens. 1988;1:410-413. [Medline] [Order article via Infotrieve]

36 Kimura M, Gardner JP, Aviv A. Agonist-evoked alkaline shift in the cytosolic pH set point for activation of Na+/H+ antiport in human platelets: the role of cytosolic Ca2+ and protein kinase C. J Biol Chem. 1990;265:21068-21074. [Abstract/Free Full Text]

37 Livne AA, Aharonovitz O, Paran E. Higher Na+/H+ exchange rate and more alkaline intracellular set-point in essential hypertension: effects of protein kinase modulation in platelets. J Hypertens. 1991;9:1013-1019. [Medline] [Order article via Infotrieve]

38 Shaiki RK, Scharf S, Faloona F, Mullis KB, Horn G, Erlich HA, Arnheim H. Enzymatic amplification of ß-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 1985;230:1350-1354. [Abstract/Free Full Text]

39 Scharf SF, Horn GT, Erlich HA. Direct cloning and sequence analysis of enzymatically amplified genomic sequences. Science. 1986;233:1076-1078. [Abstract/Free Full Text]

40 Duplŕa C, Couffinhal T, Labat L, Moreau C, Lamazičre JMD, Bonnet J. Quantitative analysis of polymerase chain reaction products using biotinylated dUTP incorporation. Anal Biochem. 1993;212:229-236. [Medline] [Order article via Infotrieve]

41 Ma TS, Brink PA, Perryman B, Roberts R. Improved quantification with validation of multiple mRNA species by polymerase chain reaction: application to human myocardial creatine kinase M and B. Cardiovasc Res. 1994;28:464-471. [Abstract/Free Full Text]

42 Chelly J, Kaplan JC, Maire P, Gautron S, Khan A. Transcription of the dystrophin gene in human muscle and non-muscle tissues. Nature. 1988;333:858-860. [Medline] [Order article via Infotrieve]

43 Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE. Use of the polymerase chain reaction in the quantitation of mdr-1 gene expression. Biochemistry. 1990;29:10351-10356. [Medline] [Order article via Infotrieve]

44 Robbins M, McKinney M. Transcriptional regulation of neuromodulin (GAP-43) in mouse neuroblastoma clone N1E-115 as evaluated by the RT/PCR method. Mol Brain Res. 1992;13:83-92. [Medline] [Order article via Infotrieve]

45 Rosskopf D, Frömter E, Siffert W. Hypertensive sodium-proton exchanger phenotype persists in immortalized lymphoblasts from essential hypertensive patients. J Clin Invest. 1993;92:2553-2559.

46 Igarashi P, Freed MI, Ganz MB, Reilly RF. Effects of chronic metabolic acidosis on Na+-H+ exchangers in LLC-PK1 renal epithelial cells. Am J Physiol. 1992;263:F83-F88. [Abstract/Free Full Text]

47 Krapf RD, Pearce D, Lynch C, Xi XP, Reudelhuber TL, Pouysségur J, Rector FC Jr. Expression of rat renal Na+/H+ antiporter mRNA levels in response to respiratory and metabolic acidosis. J Clin Invest. 1991;87:747-751.

48 Moe OW, Miller RT, Horie S, Cano A, Preisig PA, Alpern RJ. Differential regulation of Na/H antiporter by acid in renal epithelial cells and fibroblasts. J Clin Invest. 1991;88:1703-1708.

49 Fliegel L, Fröhlich O. The Na+/H+ exchanger: an update on structure, regulation and cardiac physiology. Biochem J. 1993;296:273-285.

50 Rao GN, Sardet C, Pouysségur J, Berk BC. Differential regulation of Na+/H+ antiporter expression in vascular smooth muscle cells by hypertrophic and hyperplastic stimuli. J Biol Chem. 1990; 265:19393-19396.

51 Berk BC, Elder E, Mitsuka M. Hypertrophy and hyperplasia cause differing effects on vascular smooth muscle cell Na+/H+ exchange and intracellular pH. J Biol Chem. 1990;265:19632-19637.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
J. H. Turner, M. N. Garnovskaya, S. D. Coaxum, T. M. Vlasova, M. Yakutovich, D. M. Lefler, and J. R. Raymond
Ca2+-Calmodulin and Janus Kinase 2 Are Required for Activation of Sodium-Proton Exchange by the Gi-Coupled 5-Hydroxytryptamine1a Receptor
J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 314 - 322.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. N. Orlov, N. C. Adragna, V. A. Adarichev, and P. Hamet
Genetic and biochemical determinants of abnormal monovalent ion transport in primary hypertension
Am J Physiol Cell Physiol, March 1, 1999; 276(3): C511 - C536.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
I. L. Ennis, B. V. Alvarez, M. C. C. de Hurtado, and H. E. Cingolani
Enalapril Induces Regression of Cardiac Hypertrophy and Normalization of pHi Regulatory Mechanisms
Hypertension, April 1, 1998; 31(4): 961 - 967.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
W. Koren, I. Y. Postnov, and Y. V. Postnov
Increased Na+-H+ Exchange in Red Blood Cells of Patients With Primary Aldosteronism
Hypertension, February 1, 1997; 29(2): 587 - 591.
[Abstract] [Full Text]


Home page
HypertensionHome page
O. A. Gende
Chelerythrine Inhibits Na+-H+ Exchange in Platelets From Spontaneously Hypertensive Rats
Hypertension, December 1, 1996; 28(6): 1013 - 1017.
[Abstract] [Full Text]


Home page
HypertensionHome page
D. E. Orosz and U. Hopfer
Pathophysiological Consequences of Changes in the Coupling Ratio of Na,K-ATPase for Renal Sodium Reabsorption and Its Implications for Hypertension
Hypertension, February 1, 1996; 27(2): 219 - 227.
[Abstract] [Full Text]


Home page
HypertensionHome page
W. Siffert and R. Dusing
Sodium-Proton Exchange and Primary Hypertension : An Update
Hypertension, October 1, 1995; 26(4): 649 - 655.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garciandia, A.
Right arrow Articles by Diez, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garciandia, A.
Right arrow Articles by Diez, J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*High Blood Pressure